s marcescens atcc 274 (ATCC)
ATCC is a verified supplier 
ATCC manufactures this product 
95
Structured Review
ATCC
s marcescens atcc 274
S Marcescens Atcc 274, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+marcescens+atcc+274/Serratia+marcescens/pmc12874325-14-11-13
Average 95 stars, based on 58 article reviews
S Marcescens Atcc 274, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+marcescens+atcc+274/Serratia+marcescens/pmc12874325-14-11-13
Average 95 stars, based on 58 article reviews
s marcescens atcc 274 - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Introduce:Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to amplify genes of interest pGM14 0 AATATGACGGTCAGCTTTCTTTTTATTG TTATG Forward primer to introduce aD24N mutation in ZorB in pGM70 by NEBuilder HiFi DNA Assembly. .. GAAAGCTGACCGTCATATTTGTCATTG AGACAAAAAC Reverse primer to introduce aD24N mutation in ZorB in pGM70 by NEBuilder HiFi DNA Assembly. pGM14 1 TCATAGCGGCCTCTTCTTC Forward primer to clone ZorD from Mutagenesis:Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to amplify genes of interest pGM14 0 AATATGACGGTCAGCTTTCTTTTTATTG TTATG Forward primer to introduce aD24N mutation in ZorB in pGM70 by NEBuilder HiFi DNA Assembly. .. GAAAGCTGACCGTCATATTTGTCATTG AGACAAAAAC Reverse primer to introduce aD24N mutation in ZorB in pGM70 by NEBuilder HiFi DNA Assembly. pGM14 1 TCATAGCGGCCTCTTCTTC Forward primer to clone ZorD from Plasmid Preparation:Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to linearise vector TAAAACAGAAAAACCGACTAGCTTGG Reverse primer to clone ZorABC from S. marcescens ATCC 274 in pGM39 by NEBuilder HiFi DNA Assembly. .. Primer is used to linearise vector AAATTCAGGAGGAATTCACCATGGATT CGCTGCTGCTTC Forward primer to clone ZorABC from Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to linearise vector AACAGAAAAACCGACTAGCTTGGCTG Reverse primer to clone ZorD from S. marcescens ATCC 274 downstream of ZorAB I in pGM86 by NEBuilder HiFi DNA Assembly. .. Primer is used to linearise vector tgaagaagaggccgctatgaATGACATTTGCTT TCAATCATAATG Forward primer to clone ZorD from Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to amplify genes of interest pGM85 GGTGAATTCCTCCTGAATTTCATTAC Forward primer delete ZorAB from pGM70 by KLD ATGAAATTAAGCGATATC Reverse primer delete ZorAB from pGM70 by KLD pGM86 TCATAGCGGCCTCTTCTTCAG Forward primer delete ZorAB from pGM70 by KLD 7 AACAGAAAAACCGACTAGCTTGGCTG Reverse primer delete ZorAB from pGM70 by KLD pGM12 4 GGTGAATTCCTCCTGAATTTCATTACG Forward primer to clone ZorABC from S. marcescens ATCC 274 in pGM39 by NEBuilder HiFi DNA Assembly. .. Primer is used to linearise vector TAAAACAGAAAAACCGACTAGCTTGG Reverse primer to clone ZorABC from Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to amplify genes of interest pGM12 5 GGTGAATTCCTCCTGAATTTCATTACG Forward primer to clone ZorBCD from S. marcescens ATCC 274 in pGM39 by NEBuilder HiFi DNA Assembly. .. Primer is used to linearise vector TAAAACAGAAAAACCGACTAGCTTGG Reverse primer to clone ZorBCD from Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to linearise vector GGTGAATTCCTCCTGAATTTCATTACG Reverse primer to clone ZorA I from S. marcescens ATCC 274 upstream of ZorCD in pGM85 by NEBuilder HiFi DNA Assembly. .. Primer is used to linearise vector AAATTCAGGAGGAATTCACCATGGATT CGCTGCTGCTTC Forward primer to clone ZorA I from Article Title: Modularity of Zorya defense systems during phage inhibition Article Snippet: Primer is used to amplify genes of interest pGM14 2 ATGAAATTAAGCGATATCTTCC Forward primer to clone ZorA I from S. marcescens ATCC 274 upstream of ZorCD in pGM85 by NEBuilder HiFi DNA Assembly. .. Primer is used to linearise vector GGTGAATTCCTCCTGAATTTCATTACG Reverse primer to clone ZorA I from |